Biotech Articles
Publish Your Research Online
Get Recognition - International Audience

Request for an Author Account   |   Login   |   Submit Article
 
 
HOME FAQ TOP AUTHORS FORUMS PUBLISH ARTICLE
 
 

Molecular Markers as Size and Sequence Variants

BY: SUNIL KUMAR, S.V. | Category: Others | Submitted: 2012-04-02 10:41:38
       Author Photo
Article Summary: "Molecular markers have great potential to assist plant breeders in development of improved varieties by complementing phenotypic selection. This module provides an overview of molecular markers. Technology used for genotyping is rapidly changing, requiring us to think beyond markers as bands on a gel..."


Share with Facebook Share with Linkedin Share with Twitter Share with Pinterest Email this article
     


Introduction
Molecular markers have great potential to assist plant breeders in development of improved varieties by complementing phenotypic selection. This module provides an overview of molecular markers. Technology used for genotyping is rapidly changing, requiring us to think beyond markers as bands on a gel.

The following links provide background information:
• DNA as a biochemical entity and data string
• Traditional view of molecular markers
• Assays for molecular marker genotyping
• An example of marker-assisted selection

Although previously conceptualized as "bands on a gel", molecular marker data is increasingly in the form of numbers on a spreadsheet, regardless of type of marker, as discussed below. This trend will continue to increase as the volume of sequence data increases. With the continuing decline in the cost of DNA sequencing, the volume of sequence data is increasing exponentially. We now often think of two types of molecular markers; size variants and sequence variants. Both of these types of markers are discussed below.

Molecular Markers as Size Variants
One type of mutation is the insertion/deletion class of polymorphism. These mutations can be detected as fragment-length differences. A special class of insertion/deletion polymorphisms are the Simple Sequence Repeat (SSR) polymorphisms, also called microsatellites. These polymorphisms occur in short sequences of repeated DNA. For example, one variety may have the sequence GAGCAACAACAACG which has three repeats of CAA (or AAC, depending where you start counting from). A second variety may have the sequence GAGCAACAACAACAACAACG where the trinucleotide CAA is repeated five times. SSRs typically consist of di-, tri- or tetra-nucleotide repeats. They are highly variable in genomes, with mutation rates that are up to 10-fold higher than SNPs. The increased mutation rate is thought to occur due to slipped strand mis-pairing (slippage) during DNA replication resulting in two to 20 alleles at a given locus, unlike SNPs which typically have only two alleles. As a result, SSRs have greater information content (polymorphism) than SNPs for a given marker, although their frequency in the genome is much less than SNPs. SSRs are rarely found in exons. These mutations therefore provide DNA markers that are highly variable, dispersed throughout the genome, and easily detected as size polymorphisms as long as the detection method can distinguish -2, -3, or -4 base differences.

Assaying Size Variants:
• DNA size variant detection
Molecular Markers as Sequence Variants:
By comparing DNA sequences between two or more plant varieties (or within a heterozygous plant), we can identify sequence variants as single base pair substitutions or single nucleotide polymorphisms (SNPs). These are found thoughout the genome, including in genes. When SNPs are located in genes they may change a protein and therefore the expression of a trait (phenotype). In these cases, the SNP causes a non-synonymous substitution. SNPs may also change the expression of a gene if they occur in promoters or other regulatory sequences. Detecting differences relies on comparative biology, as the alignment of the PSY1 sequence from the tomato genotype "Red Setter" with the VRT-32-1 indicates. The A/T change at position 69 and the A/G mutation at position 85 represent sequence variations that can be used for marker development.

Assaying Sequence Variation:
• Conversion to Size Variant (CAP)
• Allele Specific Primer Extension (ASPE

About Author / Additional Info:


Search this site & forums
Share this article with friends:



Share with Facebook Share with Linkedin Share with Twitter Share with Pinterest Email this article

More Social Bookmarks (Digg etc..)


Comments on this article: (0 comments so far)

Comment By Comment

Leave a Comment   |   Article Views: 2251



Additional Articles:

•   Invert Sugar Usage in Pharmaceutical Industry Grows Dramatically

•   Biofilms: Their Role in Agriculture

•   Biosensors - Immunosensors, Biochip and Bioreporter

•   Production of L-Ornithine by Evolving Cornybacterium Glutamicum




Latest Articles in "Others" category:
•   Biotechnology, Its Techniques and Human Health

•   Techniques of Biotechnology

•   Nanomedicine and Disease Treatment

•   Biotechnology and Livestock

•   Bioinformatics: Combination of Biotechnology and Information Technology

•   Gene Patenting and Its Uses

•   Polymerase Chain Reaction: A Technique of Biotechnology

•   Pharmacogenomics: Benefits and Barriers

•   Human Genome Project: Ethical and Legal Issues

•   Plant and Animal Tissue Culture: Procedure, Benefits and Limitations

•   Therapeutics and Biotechnology

•   Biotechnology: A Revolutionary Field and Biotech Challenges

•   Recombinant DNA Technology

•   Environment and Biotechnology

•   Biosensors: Role in Biotechnology

•   Human Insulin and Recombinant DNA Technology

•   Biotechnology and Its Applications

•   Genetic Engineering and its Methods

•   Types of Gene Mutations - Diseases Caused By Gene Mutation



Important Disclaimer: All articles on this website are for general information only and is not a professional or experts advice. We do not own any responsibility for correctness or authenticity of the information presented in this article, or any loss or injury resulting from it. We do not endorse these articles, we are neither affiliated with the authors of these articles nor responsible for their content. Please see our disclaimer section for complete terms.
Page copy protected against web site content infringement by Copyscape
Copyright © 2010 biotecharticles.com - Do not copy articles from this website.

ARTICLE CATEGORIES :
Agriculture Bioinformatics Applications Biotech Products Biotech Research
Biology Careers College/Edu DNA Environmental Biotech
Genetics Healthcare Industry News Issues Nanotechnology
Others Stem Cells Press Release Toxicology  


  |   Disclaimer/Privacy/TOS   |   Submission Guidelines   |   Contact Us